Sarah Rankin

Learn More
In the present study, we have identified several proteins in Swiss 3T3 cells that are phosphorylated on tyrosine in response to platelet-derived growth factor (PDGF) and exhibit an unusual bell-shaped dose-response curve with a maximum at 5 ng/ml platelet-derived growth factor (PDGF). These proteins include two that are associated with focal adhesions,(More)
The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence forms a four-stranded quadruplex structure under physiological conditions. Variations in the sequences that intervene between the guanine(More)
The c-kit gene encodes a receptor tyrosine kinase, whose engagement by its ligand triggers signals leading to cell proliferation. c-kit activity is elevated in gastrointestinal stromal tumors (GISTs), and its therapeutic inhibition by small molecules such as imatinib is clinically validated. We identified a putative quadruplex forming 21-nucleotide sequence(More)
In aqueous solution, while cytochrome c is a stably folded protein with a tightly packed structure at the secondary and tertiary levels, its heme-free precursor, apocytochrome c, shows all features of a structureless random coil. However, upon interaction with phospholipid vesicles or lysophospholipid micelles, apocytochrome c undergoes a conformational(More)
In most eukaryotic organisms, chiasmata, the connections formed between homologous chromosomes as a consequence of crossing over, are important for ensuring that the homologues move away from each other at meiosis I. Some organisms have the capacity to partition the rare homologues that have failed to experience reciprocal recombination. The yeast(More)
The role of phosphatidylinositol 3'-kinase (PI 3'-kinase) activity in platelet-derived growth factor (PDGF)-stimulated tyrosine phosphorylation of focal adhesion kinase (p125FAK) and paxillin has been examined. The tyrosine phosphorylation of p125FAK and paxillin in response to PDGF was markedly inhibited by wortmannin in a dose-dependent manner.(More)
We have suggested that in the nonhuman primate endometrium, stromal cells might play a role in mediating the effects of estrogen on the epithelium, especially during the luteal-follicular transition (LFT) when target cells normally escape from the inhibitory influence of progesterone (P). We now report that like estrogen receptors (ER), endometrial(More)
Apocytochrome c, which in aqueous solution is largely unstructured, acquires a highly alpha-helical structure upon interaction with lipid. The alpha-helix content induced in apocytochrome c depends on the lipid system, and this folding process is driven by both electrostatic and hydrophobic lipid-protein interactions. The folding kinetic mechanism of(More)
Unfolded apocytochrome c acquires an alpha-helical conformation upon interaction with lipid. Folding kinetic results below and above the lipid's CMC, together with energy transfer measurements of lipid bound states, and salt-induced compact states in solution, show that the folding transition of apocytochrome c from the unfolded state in solution to a(More)
In this study we examined the role of rho p21 in neuropeptide-stimulated tyrosine phosphorylation. Intact Swiss 3T3 cells were treated with the Clostridium botulinum C3 exoenzyme which specifically ADP ribosylates and inactivates rho p21. C3 exoenzyme treatment of cells caused a marked decrease in both bombesin- and endothelin-stimulated tyrosine(More)