Learn More
Complementary DNA clones of two mRNA species that encode β-tubulin in the brown algaEctocarpus variabilis have been isolated. Sequence analysis revealed that the encoded proteins are very similar in primary structure to homologues in other eukaryotes, and differ from each other at six of 447 amino acid residues. The β6 message shows a preference for C-or(More)
The nucleotide sequences of wheat embryo 5.8-S and 5-S rRNAs have been determined with the use of several techniques, including classic analysis of oligonucleotides generated by ribonuclease T1 and resolution on gels of terminally labelled RNA partially degraded with ribonucleases or with chemical reagents. The sequence of wheat embryo 5.8-S rRNA was found(More)
We compared the secretion of a Bacillus subtilis endo-beta-1,4-glucanase (EC 3.2.1.4) in B. subtilis and of the product from the cloned gene (pC6.3) expressed in Escherichia coli. The cloned enzyme has been isolated previously as the 52.2-kilodalton (kDa) species predicted from the gene sequence (R. M. MacKay, A. Lo, G. Willick, M. Zuker, S. Baird, M. Dove,(More)
The nucleotide sequence of the portion of a Bacillus subtilis (strain PAP115) 3 kb Pst I fragment which contains an endo-beta-1, 4-glucanase gene has been determined. This gene encodes a protein of 499 amino acid residues (Mr = 55,234) with a typical B. subtilis signal peptide. Escherichia coli which has been transformed with this gene produces an(More)
We have shown that mature 50S ribosomal subunits of Paracoccus denitrificans lack intact 23S rRNA, containing instead rRNAs of 0.56 (“16S”) and 0.37 (“14S”)x106 molecular weight. Kinetic labelling studies showed these to be derived from a 1.02x106 dalton precursor, which may itself derive from a larger and very transient “23S” species. A similar pattern of(More)
The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are (formula: see text), respectively. Specific phylogenetic relationships of P. denitrificans with purple non-sulphur bacteria, and of Prochloron with cyanobacteria are demonstrated, and unique features of potential secondary structure are described.
A number of bacteria and eukaryotes produce extracellular enzymes that degrade various types of polysaccharides including the glucans starch, cellulose and hemicellulose (xylan). The similarities in the modes of expression and specificity of enzyme classes, such as amylase, cellulose and xylanase, suggest common genetic origins for particular activities.(More)
Sequences of 5S and 5.8S rRNAs of the amoeboid protist Acanthamoeba castellanii have been determined by gel sequencing of terminally-labeled RNAs which were partially degraded with chemical reagents or ribonucleases. The sequence of the 5S rRNA is (formula, see text). This sequence is compared to eukaryotic 5S rRNA sequences previously published and fitted(More)
The complete nucleotide sequence of the cytosol 5S ribosomal ribonucleic acid of the trypanosomatid protozoan Crithidia fasciculata has been determined by a combination of T1-oligonucleotide catalog and gel sequencing techniques. The sequence is: GAGUACGACCAUACUUGAGUGAAAACACCAUAUCCCGUCCGAUUUGUGAAGUUAAGCACC(More)
Nucleotide sequences of nine eukaryotic and nine eubacterial 5S rRNAs have been selected for their diversity and subjected to analysis of primary and potential secondary structure. This analysis has allowed the quantitative confirmation of several previously made observations concerning 5S rRNA structure: (i) these two 5S rRNAs are derived from a common(More)