Paul J. Rushton

Learn More
The WRKY proteins are a superfamily of transcription factors with up to 100 representatives in Arabidopsis. Family members appear to be involved in the regulation of various physio-logical programs that are unique to plants, including pathogen defense, senescence and trichome development. In spite of the strong conservation of their DNA-binding domain, the(More)
WRKY transcription factors are one of the largest families of transcriptional regulators in plants and form integral parts of signalling webs that modulate many plant processes. Here, we review recent significant progress in WRKY transcription factor research. New findings illustrate that WRKY proteins often act as repressors as well as activators, and that(More)
We report the draft genome sequence of the model moss Physcomitrella patens and compare its features with those of flowering plants, from which it is separated by more than 400 million years, and unicellular aquatic algae. This comparison reveals genomic changes concomitant with the evolutionary movement to land, including a general increase in gene family(More)
PR1 is a pathogenesis-related protein encoded in the parsley genome by a family of three genes (PR1-1, PR1-2 and PR1-3). Loss- and gain-of-function experiments in a transient expression system demonstrated the presence of two fungal elicitor responsive elements in each of the PR1-1 and PR1-2 promoters. These elements, W1, W2 and W3, contain the sequence(More)
Parsley WRKY proteins comprise a family of plant-specific zinc-finger-type factors implicated in the regulation of genes associated with pathogen defence. In vitro, these proteins bind specifically to functionally defined TGAC-containing W box promoter elements within the Pathogenesis-Related Class10 (PR-10) genes. Here we present in vivo data demonstrating(More)
Pathogen-inducible plant promoters contain multiple cis-acting elements, only some of which may contribute to pathogen inducibility. Therefore, we made defined synthetic promoters containing tetramers of only a single type of element and present evidence that a range of cis-acting elements (boxes W1, W2, GCC, JERE, S, Gst1, and D) can mediate local gene(More)
Transcriptional activation of genes is a vital part of the plants defence system against pathogens. Cis-acting elements within the promoters of many of these genes have recently been defined and investigators have started to isolate their cognate trans-acting factors. Some of these factors have counterparts in animals, whereas others are present only in(More)
WRKY transcription factors (TFs) are key regulators of many plant processes, including the responses to biotic and abiotic stresses, senescence, seed dormancy and seed germination. For over 15 years, limited evidence has been available suggesting that WRKY TFs may play roles in regulating plant responses to the phytohormone abscisic acid (ABA), notably some(More)
Biotic and abiotic stress lead to elevated levels of jasmonic acid (JA) and its derivatives and activation of the biosynthesis of nicotine and related pyridine alkaloids in cultivated tobacco (Nicotiana tabacum L.). Among the JA-responsive genes is NtPMT1a, encoding putrescine N-methyl transferase, a key regulatory enzyme in nicotine formation. We have(More)
The promoters of wheat, barley and wild oat α-Amy2 genes contain a number of conserved cis-acting elements that bind nuclear protein, we report here the isolation of two cDNAs encoding proteins (ABF1 and ABF2) that bind specifically to one of these elements, Box 2 (ATTGACTTGACCGTCATCGG). The two proteins are unrelated to each other except for a conserved(More)