Nicola Borbone

Learn More
In recent years considerable attention has been given to the use of natural substances as anticancer drugs. The natural antioxidant dipeptide L-carnosine belongs to this class of molecules because it has been proved to have a significant anticancer activity both in vitro and in vivo. Previous studies have shown that L-carnosine inhibits the proliferation of(More)
Four new acyclic diterpene glycosides named capsianosides (1-4), together with 12 known compounds, were isolated from the fresh sweet pepper fruits of Capsicum annuum L., a plant used as a vegetable food, spice, and external medicine. The chemical structures of new natural compounds, as well as their absolute configurations, were established by means of(More)
Computational techniques, and in particular molecular dynamics (MD) simulations, have been successfully used as a complementary technique to predict and analyse the structural behaviour of nucleic acids, including peptide nucleic acid- (PNA-) RNA hybrids. This study shows that a 7-base long PNA complementary to the seed region of miR-509-3p, one of the(More)
An acyclic pyrimidine analogue, containing a five-member cycle fused on the pyrimidine ring, was synthesized and introduced at position 7 or 12 of the 15-mer oligodeoxynucleotide GGTTGGTGTGGTTGG, known as thrombin-binding aptamer (TBA). Characterization by 1H NMR and CD spectroscopies of the resulting aptamers, TBA-T7b and TBA-T12b, showed their ability to(More)
A new modified acyclic nucleoside, namely N(1)-(3-hydroxy-2-hydroxymethyl-2-methylpropyl)-thymidine, was synthesized and transformed into a building block useful for oligonucleotide (ON) automated synthesis. A series of modified thrombin binding aptamers (TBAs) in which the new acyclic nucleoside replaces, one at the time, the thymidine residues were then(More)
Two diglucoside stilbene trimers and a benzoisofuranone derivative were isolated from Foeniculum vulgare fruit together with nine known compounds. Their structures were elucidated by spectral methods including 1D, 2D NMR and MS and chemical methods. Antioxidant activity was tested using three methods: DPPH(), total antioxidant capacity and assay of lipid(More)
The solid phase syntheses of the bunch oligonucleotides and based on the sequences of the natural oligodeoxynucleotides (ODNs) d(TG2TG2C) and d(CG2TG2T), respectively, attached to a non-nucleotidic tetrabranched linker, are reported. Bunch-ODNs and were shown to form more stable monomolecular parallel G-quadruplexes and when compared with their(More)
Laurus nobilis L. leaves are widely used in cooking and in folk medicine. Five new megastigmane glucosides (2-4, 7, and 9) named laurosides A-E and a new phenolic glucoside 12 were isolated from the methanolic extract of L. nobilis L. leaves, along with 10 known components: megastigmane (5), megastigmane glucosides (1, 6, 8, 10, and 11), aromatic compounds(More)
The cKit87up sequence d((5')AGGGAGGGCGCTGGGAGGAGGG(3')) can form a unique G-quadruplex structure in the promoter region of the human c-kit protooncogene. It provides a peculiar platform for the design of selective quadruplex-binding agents, which could potentially repress the protooncogene transcription. In this study, we examined the binding of a small(More)