Nataša Nikolić

Learn More
BACKGROUND AND AIMS Physical exercise leads to substantial adaptive responses in skeletal muscles and plays a central role in a healthy life style. Since exercise induces major systemic responses, underlying cellular mechanisms are difficult to study in vivo. It was therefore desirable to develop an in vitro model that would resemble training in cultured(More)
Cultured human myotubes have a low mitochondrial oxidative potential. This study aims to remodel energy metabolism in myotubes by replacing glucose with galactose during growth and differentiation to ultimately examine the consequences for fatty acid and glucose metabolism. Exposure to galactose showed an increased [(14)C]oleic acid oxidation, whereas(More)
We investigated the effects of PGC-1α (peroxisome proliferator-activated receptor γ coactivator-1α) overexpression on the oxidative capacity of human skeletal muscle cells ex vivo. PGC-1α overexpression increased the oxidation rate of palmitic acid and mRNA expression of genes regulating lipid metabolism, mitochondrial biogenesis, and function in human(More)
Unfortunately there was a mistake in Figure 7. The primer used for mRNA expression was actually MYH1, which regulates expression of MHC type IIx muscle fibers and not MHC type I as stated in the figure. However, we have repeated the experiment with the correct primer MYH7 (acc no. NM000257.2, F: CTCTGCACAGGGAAAATCT-GAA, R: CCCCTGGAGACTTTGTCTCATT), and the(More)
This study explores the pharmacokinetics of 22-S-hydroxycholesterol (22SHC) in vivo in rats. We also carried out a metabolic study to explore whether the beneficial effects observed of 22SHC on glucose and lipid metabolism in vitro could be seen in vivo in rats. In the pharmacokinetic study, rats were given 50 mg/kg of [3H]22-S-hydroxycholesterol before(More)
  • 1