Learn More
Phylogenetic relationships of 30 diploid species of Triticeae (Poaceae) representing 19 genomes were estimated from the sequences of the internal transcribed spacer (ITS) region of nuclear ribosomal DNA. The ITS sequence phylogeny indicated that: (i) each genome group of species is monophyletic, concordant with cytogenetic evidence; (ii) Hordeum (I) and(More)
Entire sequences of the internal transcribed spacers (ITSs) and 5.8S subunit of nuclear ribosomal DNA (nrDNA) were obtained from nine grass species by direct double-stranded sequencing of polymerase chain reaction (PCR) amplified DNA fragments. These sequences from subfamily Pooideae (Triticum aestivum, Crithodium monococcum, Sitopsis speltoides, Hordeum(More)
Phylogenetic relationships of the Poaceae subfamily, Pooideae, were estimated from the sequences of the internal transcribed spacer (ITS) region of nuclear ribosomal DNA. The entire ITS region of 25 species belonging to 19 genera representing seven tribes was directly sequenced from polymerase chain reaction (PCR)-amplified DNA fragments. The published(More)
Molecular genetic maps were constructed for two full-sib populations, TTC1 and TTC2, derived from two Leymus triticoides x Leymus cinereus hybrids and one common Leymus triticoides tester. Informative DNA markers were detected using 21 EcoRI-MseI and 17 PstI-MseI AFLP primer combinations, 36 anchored SSR or STS primer pairs, and 9 anchored RFLP probes. The(More)
The complete internal transcribed spacer (ITS) region (601 bp) between 18S and 26S regions of rRNA genes of mountain rye (Secale montanum Guss.) was amplified by the polymerase chain reaction (PCR) and sequenced by Sanger's dideoxy method [1]. Primers for PCR and sequencing, ITS5(F)-5' GGAAGTAAAAGTCGTAACAAGG 3' and ITS4(R)-5' TCCTCCGCTTATTGATATGC 3' as(More)
The DNA nucleotides between the 18S and 26S rRNA genes in diploid Triticum speltoides L. (Tausch) Gren. ex Richter were amplified by the polymerase chain reaction (PCR) and sequenced by Sanger's dideoxy method [ 1 ]. Primers for PCR and sequencing, ITS 5(F)-5' GGAAGTAAAAGTCGTAACAAGG 3' and ITS4(R)-5' TCCTCCGCTTATTGATATGC 3' as designed by White et al. [2](More)
Photosynthesis, photosynthate partitioning into foliar starch, and translocation were investigated in soybean plants (Glycine max (L.) Merr. cv. Amsoy 71), grown under different photoperiods and photosynthetic periods to determine the controls of leaf starch accumulation. Starch accumulation rates in soybean leaves were inversely related to the length of(More)
The savannas (cerrado) of south-central Brazil are currently subjected to frequent anthropogenic burning, causing widespread reduction in tree density. Increasing concentrations of atmospheric CO2 could reduce the impact of such frequent burning by increasing the availability of nonstructural carbohydrate, which is necessary for resprouting. We tested the(More)
Triticeae contains hundreds of species of both annual and perennial types. Although substantial genomic tools are available for annual Triticeae cereals such as wheat and barley, the perennial Triticeae lack sufficient genomic resources for genetic mapping or diversity research. To increase the amount of sequence information available in the perennial(More)
Microsite conditions influence plant development and resource allocation of Dactylis glomerata L. (orchardgrass), a traditional pasture species with potential as an understory crop in woodlots. A field experiment was conducted to determine how open (O), shaded woodland (W) and open-to-shaded woodland transition zone (EO, EW) microsites influenced the(More)