Learn More
We describe the use of gold nanoparticle-oligonucleotide complexes as intracellular gene regulation agents for the control of protein expression in cells. These oligonucleotide-modified nanoparticles have affinity constants for complementary nucleic acids that are higher than their unmodified oligonucleotide counterparts, are less susceptible to degradation(More)
A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants(More)
BACKGROUND The p38 mitogen-activated protein kinase (p38 MAPK) is an important intracellular signal transduction pathway involved in TGF-β1-induced epithelial-mesenchymal transition (EMT). Sema4C, a member of the semaphorin family, was found to be essential for the activation of p38 MAPK. However, the role of Sema4C in promoting TGF-β1-induced EMT is(More)
We report the development of a novel colorimetric nitrite and nitrate ion assay based upon gold nanoparticle probes functionalized with Griess reaction reagents. This assay takes advantage of the distance-dependent plasmonic properties of the gold nanoparticles and the ability of nitrite ion to facilitate the cross coupling of novel nanoparticle probes(More)
A simple method to amplify the electrochemical signal by an aptamer with 22 bases modified with CdS hollow nanospheres (CdSHNs) was described. Using the thrombin as a model, the interaction between the aptamer and CdSHNs was characterized by cyclic voltammetry, electrochemical impedance spectroscopy and circular dichroism spectroscopy. CdSHNs promoted the(More)
We have synthesized a porous Mo-based composite obtained from a polyoxometalate-based metal-organic framework and graphene oxide (POMOFs/GO) using a simple one-pot method. The MoO2 @PC-RGO hybrid material derived from the POMOFs/GO composite is prepared at a relatively low carbonization temperature, which presents a superior activity for the(More)
A low potential and competitive photoelectrochemical biosensing platform was developed using quantum dots sensitized titanium dioxide decorated reduced graphene oxide (TiO2-RGO) nanocomposites. The nanocomposites were prepared through electrostatic interaction between mercaptoacetic acid wrapped CdSe quantum dots with negative charge and TiO2-RGO hybrids(More)