Learn More
Chronic hypoxia in the renal parenchyma is thought to induce epithelial-to-mesenchymal transition (EMT), leading to fibrogenesis and ultimately end-stage renal failure. Biliverdin reductase, recently identified as a serine/threonine/tyrosine kinase that may activate phosphatidylinositol 3-kinase (PI3K) and Akt, is upregulated in response to reactive oxygen(More)
The interleukin (IL)-17 gene plays a key role in host defence against infections from microbes, including Mycobacterium tuberculosis. Genetic factors contribute to host defence. However, whether genetic variation in IL-17 is associated with altered susceptibility to tuberculosis is unknown. A total of 596 pulmonary tuberculosis (PTB) patients, 176(More)
A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants(More)
We describe the use of gold nanoparticle-oligonucleotide complexes as intracellular gene regulation agents for the control of protein expression in cells. These oligonucleotide-modified nanoparticles have affinity constants for complementary nucleic acids that are higher than their unmodified oligonucleotide counterparts, are less susceptible to degradation(More)
Diabetes mellitus (DM) and hypercholesterolemia (HC) have emerged as major risk factors for Alzheimer's disease, highlighting the importance of vascular health to normal brain functioning. Our previous study showed that DM and HC favor the development of advanced coronary atherosclerosis in a porcine model, and that treatment with darapladib, an inhibitor(More)
The presence of self-reactive IgG autoantibodies in human sera is largely thought to represent a breakdown in central tolerance and is typically regarded as a harbinger of autoimmune pathology. In the present study, immune-response profiling of human serum from 166 individuals via human protein microarrays demonstrates that IgG autoantibodies are abundant(More)
This research attempts to clarify the cause for poor oral absorption of ginsenoside Rb1 (Rb1), one main ingredient of the well known Panax notoginseng saponins (PNS) for curing hemorrhage. Caco-2 cell monolayers were used as an in vitro model to reveal the transport mechanism of Rb1 across the intestinal mucosa. Moreover, the serum concentration-time(More)
BACKGROUND To assess whether biomarker τ protein could differentiate between Alzheimer's disease (AD) and vascular dementia (VaD). METHODS We conducted a comprehensive search to identify studies on τ protein, patients with AD, and patients with VaD. Cerebrospinal fluid (CSF) τ protein levels were compared to discriminate among patients with AD, healthy(More)
Previous studies have shown that functionalized gold nanoparticles (AuNPs) can be used as a general platform for loading and delivering DNA oligonucleotides and short hairpin RNA to living systems. Here, we report the ability of functionalized AuNP to deliver RNA aptamers into the nuclei of human cells. An in vitro-synthesized RNA aptamer specific to the(More)
MicroRNAs (miRNAs) are gaining recognition as essential regulators involved in many biological processes, and they are emerging as therapeutic targets for treating disease. Here, we introduce a method for effective delivery of anti-miRNA oligonucleotides (AMOs) using functionalized gold nanoparticles (AuNPs). To demonstrate the ability of AMOs to silence(More)