Michael A. O'Donnell

Learn More
Mycobacterium bovis bacillus Calmette-Guérin (BCG) has become the predominant conservative treatment for nonmuscle invasive bladder cancer. Its mechanism of action continues to be defined but has been shown to involve a T helper type 1 (Th1) immunomodulatory response. While BCG treatment is the current standard of care, a significant proportion of patients(More)
The Epstein-Barr virus (EBV)-encoded nuclear antigen EBNA1 is critical for the persistence of the viral episome in replicating EBV-transformed human B cells. Therefore, all EBV-induced tumors express this foreign antigen. However, EBNA1 is invisible to CD8(+) cytotoxic T lymphocytes because its Gly/Ala repeat domain prevents proteasome-dependent processing(More)
For bladder cancer, intravesical chemo/immunotherapy is widely used as adjuvant therapies after surgical transurethal resection, while systemic therapy is typically reserved for higher stage, muscle-invading, or metastatic diseases. The goal of intravesical therapy is to eradicate existing or residual tumors through direct cytoablation or immunostimulation.(More)
Purkinje cells are uniquely susceptible to a number of physical, chemical, and genetic insults both during development and in the mature state. We have previously shown that when the postmitotic state of murine Purkinje cells is altered by inactivation of the retinoblastoma tumor susceptibility protein (pRb), immature as well as mature Purkinje cells(More)
Bladder cancer is the fifth most common malignant disease in the United States with an annual incidence of around 63,210 new cases and 13,180 deaths. The cost for providing care for patients with bladder cancer disease is high. Bladder cancer treatment options such as immunotherapy, chemotherapy, radiation therapy, transurethral resection, and cystectomy,(More)
BACKGROUND Despite being a mainstay for treating superficial bladder carcinoma and a promising agent for interstitial cystitis, the precise mechanism of Bacillus Calmette-Guerin (BCG) remains poorly understood. It is particularly unclear whether BCG is capable of altering gene expression beyond its well-recognized pro-inflammatory effects and how this(More)
Intravesical instillation of Mycobacterium bovis bacillus Calmette-Guérin (BCG) has been used for treating bladder cancer for 3 decades. However, BCG therapy is ineffective in approximately 30-40% of cases. Since evidence supports the T helper type 1 (Th1) response to be essential in BCG-induced tumor destruction, studies have focused on enhancing BCG(More)
PRIMER FORWARD REVERSE ARL6 gcgctctcccaaaagtaata gcaaaggacgtgaaggaaag DNAJC5 gtgcatggtgctcacaggta tttgctgctagtttgctcaca CSK gccctcaaagcacagatgtt ggcccagctactcaggactt FAF1 gctcaggccagtcttaattgtt ctctgggcacaagtcctttag Fkbpl ggagatggaggctatggagaa gtcagcagcagtcggagag GBP2 tgtgccccaatgaaaaataa cagaggaggaggtcggattc GZMA agcccaaaagggtcaagact tccctcaagaaagccacatt(More)
BACKGROUND Despite being a mainstay for treating superficial bladder carcinoma and a promising agent for interstitial cystitis, the precise mechanism of Bacillus Calmette-Guerin (BCG) remains poorly understood. It is particularly unclear whether BCG is capable of altering gene expression in the bladder target organ beyond its well-recognized(More)