Mathieu Gourgues

Learn More
Sexual reproduction involves epigenetic reprogramming comprising DNA methylation and histone modifications. In addition, dynamics of HISTONE3 (H3) variant H3.3 upon fertilization are conserved in animals, suggesting an essential role. In contrast to H3, H3.3 marks actively transcribed regions of the genome and can be deposited in a replication-independent(More)
In Angiosperms, the male gametes are delivered to the female gametes through the maternal reproductive tissue by the pollen tube. Upon arrival, the pollen tube releases the two sperm cells, permitting double fertilization to take place. Although the critical role of the female gametophyte in pollen tube reception has been demonstrated, the underlying(More)
Root-knot nematodes (RKN) are obligate biotrophic parasites that settle close to the vascular tissues in roots, where they induce the differentiation of specialized feeding cells and maintain a compatible interaction for 3 to 8 weeks. Transcriptome analyses of the plant response to parasitic infection have shown that plant defenses are strictly controlled(More)
Data on plant pathogenic oomycetes are scarce and little is known about the early events leading to the onset of infection. The aim of this work was to analyze the penetration process of the soil-borne plant pathogen Phytophthora parasitica, which has a wide host range. Here, we performed a cytological analysis of the colonization of the first plant cell(More)
Angiosperms sexual reproduction involves interactions between the two female gametes in the embryo sac and the two male gametes released by the pollen tube. The two synergids of the embryo sac express the FERONIA/SIRENE receptor-like kinase, which controls the discharge of the two sperm cells from the pollen tube. FER/SRN may respond to a ligand from the(More)
Pathogenic oomycetes have evolved RXLR effectors to thwart plant defense mechanisms and invade host tissues. We analysed the function of one of these effectors (Penetration-Specific Effector 1 (PSE1)) whose transcript is transiently accumulated during penetration of host roots by the oomycete Phytophthora parasitica. Expression of PSE1 protein in tobacco(More)
A sequence-characterised amplified region marker was identified in the phytopathogenic fungus Leptosphaeria maculans, which generated a single-banding pattern corresponding to six alleles showing size polymorphism between L. maculans field isolates. The size polymorphism was due to 2–7 tandem repeats of the 23-bp motif 5′ TCTTACTTACATACACACCTCCC 3′. The(More)
Map-based cloning of the avirulence gene AvrLm1 of Leptosphaeria maculans was initiated utilizing a genetic map of the fungus and a BAC library constructed from an AvrLm1 isolate. Seven polymorphic DNA markers closely linked to AvrLm1 were identified. Of these, two were shown to border the locus on its 5' end and were present, with size polymorphism, in(More)
SUMMARY *The outcome of plant-microbe interactions is determined by a fine-tuned molecular interplay between the two partners. Little is currently known about the molecular dialogue between plant roots and filamentous pathogens. We describe here a new pathosystem for the analysis of molecular mechanisms occurring during the establishment of a compatible(More)
Oomycetes from the genus Phytophthora are fungus-like plant pathogens that are devastating for agriculture and natural ecosystems. Due to their particular physiological characteristics, no efficient treatments against diseases caused by these microorganisms are presently available. To develop such treatments, it appears essential to dissect the molecular(More)