Learn More
Dendritic cells (DC) are a subset of leukocytes whose major function is antigen presentation. We investigated the phenotype and function of enriched (95-98.5%) rat DC. We show that both spleen and thymus DC express the natural killer cell receptor protein 1 (NKR-P1) as a disulfide linked homodimer of 60 kD. Freshly isolated DC express a low level of NKR-P1,(More)
Toll-like receptors (TLRs) play a crucial role in the initiation of innate responses following microbial infection and also in adaptive immune responses by orchestrating the activation of different cell populations. TLRs are expressed at high levels in antigen-presenting cells and recent studies have demonstrated the expression and biological role of TLRs(More)
We recently showed that injection of recipient-type immature bone marrow-derived dendritic cells (iBMDCs) the day before transplantation induced a significant prolongation of allograft survival. This study aimed at improving the administration protocol to induce allograft tolerance. Various amounts of iBMDCs were administered to syngeneic LEW.1A rats before(More)
We identified a novel rat gene specifically overexpressed in tolerated heart allografts in a model of tolerance induced by donor-specific blood transfusion (DST). We named this gene TORID, for tolerance-related and induced transcript. We show that TORID expression can be attributed to non-T cells infiltrating tolerated grafts. Interestingly, TORID(More)
Cell therapy and the use of mAbs that interfere with T cell effector functions constitute promising approaches for the control of allograft rejection. In the current study, we investigated a novel approach combining administration of autologous tolerogenic dendritic cells with short-term treatment with CD3-specific Abs. Permanent acceptance of pancreatic(More)
C-type lectin receptors have recently been described as playing crucial roles in immunity and homeostasis since these proteins are able to recognize pathogens as well as self-Ags. We identified the C-type lectin-like receptor-1, CLEC-1, as being overexpressed in a model of rat allograft tolerance. We previously described in this model the expression of(More)
BN ~TGTGAGTGTGTTCATTCCACCACGTGATGCCTTCTCTGGCCCTGCACCCCGC 75 A V V E M N P N V S V F I P P R D A F S G P A P R PVG ........................................ ~ .................................. BN ~GTCCAGACTCATCTGCGAGGCCACC~CTTCAGTCCCAAACAGATCACAGTATCCTGGCTACAGGATGGQ~G 150 K S R L I C E A T N F S P K Q I T V S W L Q D G K PVG(More)
BACKGROUND Progressively better therapies have largely prevented or at least effectively treated acute allograft rejection. Consequently, the long-term survival of solid organ transplants has increasingly become limited primarily by the development of chronic allograft rejection. The mechanisms of chronic rejection remain largely unknown and the induction(More)
Organ transplantation appears today to be the best alternative to replace the loss of vital organs induced by various diseases. Transplants can, however, also be rejected by the recipient. In this review, we provide an overview of the mechanisms and the cells/molecules involved in acute and chronic rejections. T cells and B cells mainly control the(More)
Regulatory T cells (Treg) have been identified as playing a pivotal role in the control of tolerance and in the suppression of pathologic immune responses in autoimmune diseases, transplantation, and graft-versus-host disease. Treg expanded ex vivo by dendritic cells could be potential reagents to promote antigen-specific tolerance in vivo. However, in vivo(More)