Maria-Cristina Cuturi

Learn More
Organ transplantation is the main alternative to the loss of vital organ function from various diseases. However, to avoid graft rejection, transplant patients are treated with immunosuppressive drugs that have adverse side effects. A new emerging approach to reduce the administration of immunosuppressive drugs is to co-treat patients with cell therapy(More)
Dendritic cells (DC) are a subset of leukocytes whose major function is antigen presentation. We investigated the phenotype and function of enriched (95-98.5%) rat DC. We show that both spleen and thymus DC express the natural killer cell receptor protein 1 (NKR-P1) as a disulfide linked homodimer of 60 kD. Freshly isolated DC express a low level of NKR-P1,(More)
C-type lectin receptors have recently been described as playing crucial roles in immunity and homeostasis since these proteins are able to recognize pathogens as well as self-Ags. We identified the C-type lectin-like receptor-1, CLEC-1, as being overexpressed in a model of rat allograft tolerance. We previously described in this model the expression of(More)
Toll-like receptors (TLRs) play a crucial role in the initiation of innate responses following microbial infection and also in adaptive immune responses by orchestrating the activation of different cell populations. TLRs are expressed at high levels in antigen-presenting cells and recent studies have demonstrated the expression and biological role of TLRs(More)
Organ transplantation appears today to be the best alternative to replace the loss of vital organs induced by various diseases. Transplants can, however, also be rejected by the recipient. In this review, we provide an overview of the mechanisms and the cells/molecules involved in acute and chronic rejections. T cells and B cells mainly control the(More)
The use of immunosuppressive (IS) drugs to treat transplant recipients has markedly reduced the incidence of acute rejection and early graft loss. However, such treatments have numerous adverse side effects and fail to prevent chronic allograft dysfunction. In this context, therapies based on the adoptive transfer of regulatory cells are promising(More)
Cell therapy and the use of mAbs that interfere with T cell effector functions constitute promising approaches for the control of allograft rejection. In the current study, we investigated a novel approach combining administration of autologous tolerogenic dendritic cells with short-term treatment with CD3-specific Abs. Permanent acceptance of pancreatic(More)
DCs play a central role in the development of innate and adaptive immunity but also in the induction and maintenance of immune tolerance. Identification of factors that govern DC activation, their maturation state, and their capacity to induce proinflammatory or tolerogeneic responses therefore represents a crucial aim of research. We previously identified(More)
We identified a novel rat gene specifically overexpressed in tolerated heart allografts in a model of tolerance induced by donor-specific blood transfusion (DST). We named this gene TORID, for tolerance-related and induced transcript. We show that TORID expression can be attributed to non-T cells infiltrating tolerated grafts. Interestingly, TORID(More)
BN ~TGTGAGTGTGTTCATTCCACCACGTGATGCCTTCTCTGGCCCTGCACCCCGC 75 A V V E M N P N V S V F I P P R D A F S G P A P R PVG ........................................ ~ .................................. BN ~GTCCAGACTCATCTGCGAGGCCACC~CTTCAGTCCCAAACAGATCACAGTATCCTGGCTACAGGATGGQ~G 150 K S R L I C E A T N F S P K Q I T V S W L Q D G K PVG(More)