Marc Beauregard

Learn More
The lack of a commercially available robust and inexpensive laccase is a major barrier to the widespread application of this enzyme in various industrial sectors. By using an efficient system developed in Streptomyces lividans, we have produced by homologous expression 350 mg L−1 of a bacterial laccase with a high purity and without any extensive(More)
Human serum albumin (HSA) is a major transporter for delivering several endogenous compounds including fatty acids in vivo. Even though HSA is the primary target of fatty acid binding, the effects of cationic lipid on protein stability and conformation have not been investigated. The aim of this study was to examine the interaction of human serum albumin(More)
Soil function may be affected by cropping practices impacting the soil microbial community. The effect of different phosphorus (P) fertilization rates (0, 20, or 40 kg P2O5 ha−1) on soil microbial diversity was studied in 8-year-old alfalfa monocultures. The hypothesis that P fertilization modifies soil microbial community was tested using denaturing(More)
Human triosephosphate isomerase (hTIM), a dimeric enzyme, was altered by site-directed mutagenesis in order to determine whether it can be dissociated into monomers. Two hTIM mutants were produced, in which a glutamine residue was substituted for either Met14 or Arg98, both of which are interface residuces. These substitutions strongly interfere with TIM(More)
A novel gene encoding an esterase from Geobacillus thermodenitrificans strain CMB-A2 was cloned, sequenced and functionally expressed in Escherichia coli M15. Sequence analysis revealed an open reading frame of 747 bp corresponding to a polypeptide of 249 amino acid residues (named EstGtA2). After purification, a specific activity of 2.58 U mg(-1) was(More)
BACKGROUND Biodiesels are methyl esters of fatty acids that are usually produced by base catalyzed transesterification of triacylglyerol with methanol. Some lipase enzymes are effective catalysts for biodiesel synthesis and have many potential advantages over traditional base or acid catalyzed transesterification. Natural lipases are often rapidly(More)
Primers used for cloning Sites / Vector Reference 5' TAATTAGGTACCTATGAAAGAACGATATCCTGTACTT 3' Fwd KpnI / pQE31 Ref 7. 5' TATTAAAGCTTTCAAGCATGTTTGGCGAA 3' Rev HindIII / pQE31 5’ CTCGGTACATATGAAAGAACGATATCCTGTACTTC 3’ Fwd NdeI / pET28 This study 5’ GTGCGGCCGTCAAGCATGTTTGGCGAAAAACTG 3’ Rev EagI / pET28 Mutagenic primers Mutation Source 5'(More)
Colored wastewater from textile industries is a consequence of dye manufacturing processes. Two percent of dyes that are produced are discharged directly in aqueous effluent and more than 10% are subsequently lost during the textile coloration process. It is not surprising that these compounds have become a major environmental concern. In that context, we(More)
The protective role of reactive oxygen scavengers against photodamage was studied in isolated photosystem (PS) I submembrane fractions illuminated (2000 microE x m(-2) x s(-1)) for various periods at 4 degrees C. The photochemical activity of the submembrane fractions measured as P700 photooxidation was significantly protected in the presence of histidine(More)
The importance and urgency of providing humans and animals with quality proteins are reflected in the growing scientific and industrial interest in augmenting the nutritive value of the world's protein sources. Such nutritive value is determined by the protein content in 'essential amino acids', those that cannot be synthesized de novo and that must be(More)