Learn More
TTGCTGAAGATCGATGCACCATGCA TATCCATCTCTATATAAAGCCATGCGATCCCACCGATTCTTGCACACACACTAGCTACTT CTACTTCTATCATACCAAACAAACTAGCTTAATTTGCATTGCATCACATTGCCGGCCGCC ATGAGAGCTCTCGCTCTCGCGGTGGTGGCCATGGCGGTGGTGGCCGTGCGCGGCGAGCAG M R A L A L A V V A M A V V A V R G E Q TGCGGCAGCCAGGCCGGCGGCGCGCTCTGCCCCAACTGCCTCTGCTGCAGCCAGTACGGC C G S Q A G G A L C P N C L C C S Q Y G(More)
Eighteen Pseudomonas aeruginosa strains were examined for their ability to convert oleic acid to produce 10-hydroxy-8(E)-octadecenoic acid (HOD), which was structurally confirmed by GC-MS, NMR, and FTIR. There were no substantial amounts of other new compounds found in the fermentation broths in addition to HOD and 7,10-dihydroxy-8(E)-octadecenoic acid(More)
Nanomaterials have been emerging as a new group of contaminants in the environment. We reported the use of a bacterial reverse mutation assay (Ames assay) to evaluate the mutagenicity of five metal oxide nanoparticles Al(2)O(3), Co(3)O(4), CuO, TiO(2), and ZnO in this study. Results showed the mutagenicity was negative for four nanoparticles (Al(2)O(3),(More)
A λgt11 cDNA library, constructed from poly(A)+ RNA isolated from immature rice seed endosperm, was screened with affinity-purified antibodies against the rice storage protein called α-globulin (previously), or the 19 kDa globulin (our term). A positive clone was isolated and sequenced and shown to encode a 21 kDa precursor for the 19 kDa globulin, based on(More)
Deoxyhypusine hydroxylase is the second of the two enzymes that catalyzes the maturation of eukaryotic initiation factor 5A (eIF5A). The mature eIF5A is the only known protein in eukaryotic cells that contains the unusual amino acid hypusine (N(epsilon)-(4-amino-2(R)-hydroxybutyl)lysine). Synthesis of hypusine is essential for the function of eIF5A in(More)
A cDNA encoding a putative superoxide dismutase (SOD) was identified in expressed sequence tags of Antrodia camphorata, a medicinal mushroom found only in Taiwan. The deduced protein was aligned with Mn-SODs and Fe-SODs from other organisms, this SOD showed greater homology to Mn-SOD. Functional A. camphorata SOD protein was overexpressed in yeast and(More)
Antrodia camphorata is a unique medicinal mushroom found only in Taiwan. It has been used as a remedy for various diseases in folk medicine. Antrodia camphorata has been shown to exhibit antioxidative effects. Peroxiredoxins play important roles in antioxidation and cell signaling. A gene encoding an antioxidant enzyme, 1-cysteine peroxiredoxin (1-Cys Prx),(More)
Ascorbate peroxidase (Apx) plays important roles both as a reductant and as a H2O2 scavenger via ascorbate (AsA). In this paper, we discuss how a ClApx cDNA (1,068 bp, GQ465430) encoding a putative Apx was cloned from lemon (Citrus limon). The deduced amino acid sequence is similar to the Apxes from other plant species. A 3-D structural model of ClApx was(More)
The side chains of Arg(50) and Arg(52) at positions P(6)' and P(8)', respectively, anchor the binding loop to the protein scaffold by means of hydrogen bonds in Cucurbita maxima trypsin inhibitor-V (CMTI-V), a potato I family member. Here, we have investigated the relative contributions of Arg(50) and Arg(52) to the binding-loop flexibility and stability by(More)
Glutaredoxins (Grxs) play important roles in the reduction of disulfides via reduced glutathione as a reductant. A cDNA (503 bp, EU193660) encoding a putative Grx was cloned from Taiwanofugus camphorata (Tc). The deduced amino acid sequence is conserved among the reported dithiol Grxs. A 3D homology structure was created for this TcGrx. To characterize the(More)