Learn More
Sonic Hedgehog (Shh) is a secreted protein that controls cell fate and mitogenesis in the developing nervous system. Here we show that a constitutively active form of Smoothened (Smo-M2) mimics concentration-dependent actions of Shh in the developing neural tube, including activation of ventral marker genes (HNF3beta, patched, Nkx2.2, netrin-1), suppression(More)
The T-DNA transfer process of Agrobacterium tumefaciens is activated by the induction of the expression of the Ti plasmid virulence (vir) loci by plant signal molecules such as acetosyringone. The vir gene products act in trans to mobilize the T-DNA element from the bacterial Ti plasmid. The T-DNA is bounded by 25-base pair direct repeat sequences, which(More)
Multivalent molecules with repetitive structures including bacterial capsular polysaccharides and viral capsids elicit antibody responses through B cell receptor (BCR) crosslinking in the absence of T cell help. We report that immunization with these T cell-independent type 2 (TI-2) antigens causes up-regulation of endogenous retrovirus (ERV) RNAs in(More)
We have determined which sequences at the right border of the T-DNA region of the nopaline C58 Ti plasmid are required for transfer and/or integration of the T-DNA into the plant cell genome. The results indicate that the 25 bp T-DNA terminus repeat sequence, TGACAGGATATATTGGCGGGTAAAC, is directly responsible for T-DNA transfer; furthermore, this sequence(More)
  • 1