Julian Leon Huppert

Learn More
Guanine-rich DNA sequences of a particular form have the ability to fold into four-stranded structures called G-quadruplexes. In this paper, we present a working rule to predict which primary sequences can form this structure, and describe a search algorithm to identify such sequences in genomic DNA. We count the number of quadruplexes found in the human(More)
Certain G-rich DNA sequences readily form four-stranded structures called G-quadruplexes. These sequence motifs are located in telomeres as a repeated unit, and elsewhere in the genome, where their function is currently unknown. It has been proposed that G-quadruplexes may be directly involved in gene regulation at the level of transcription. In support of(More)
Guanine-rich nucleic acid sequences can adopt noncanonical four-stranded secondary structures called guanine (G)-quadruplexes. Bioinformatics analysis suggests that G-quadruplex motifs are prevalent in genomes, which raises the need to elucidate their function. There is now evidence for the existence of DNA G-quadruplexes at telomeres with associated(More)
There are many structures that can be adopted by nucleic acids other than the famous Watson-Crick duplex form. This tutorial review describes the guanine rich G-quadruplex structure, highlighting the chemical interactions governing its formation, and the topological variants that exist. The methods that are used to study G-quadruplex structures are(More)
Four-stranded G-rich DNA structures called G-quadruplexes have been the subject of increasing interest recently. Experimental and computational techniques have been used to implicate them in important biological processes such as transcription and translation. In this minireview, I discuss how they form, what structures they adopt and with what stability. I(More)
The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence forms a four-stranded quadruplex structure under physiological conditions. Variations in the sequences that intervene between the guanine(More)
Guanine-rich DNA sequences can form a large number of structurally diverse quadruplexes. These vary in terms of strand polarity, loop composition, and conformation. We have derived guidelines for understanding the influence of loop length on the structure adopted by intramolecular quadruplex-forming sequences, using a combination of experimental (using CD(More)
The c-kit gene encodes a receptor tyrosine kinase, whose engagement by its ligand triggers signals leading to cell proliferation. c-kit activity is elevated in gastrointestinal stromal tumors (GISTs), and its therapeutic inhibition by small molecules such as imatinib is clinically validated. We identified a putative quadruplex forming 21-nucleotide sequence(More)
We report the generation and analysis of functional data from multiple, diverse experiments performed on a targeted 1% of the human genome as part of the pilot phase of the ENCODE Project. These data have been further integrated and augmented by a number of evolutionary and computational analyses. Together, our results advance the collective knowledge about(More)
Molecular mechanisms that regulate gene expression can occur either before or after transcription. The information for post-transcriptional regulation can lie within the sequence or structure of the RNA transcript and it has been proposed that G-quadruplex nucleic acid sequence motifs may regulate translation as well as transcription. Here, we have explored(More)