Jan-Terje Andersen

Learn More
The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence can be fitted to the secondary structural models recently proposed for(More)
Just previous to the onset of parturition, a number of genes such as the one that codes for connexin-43 (Cx43) gap junction protein are induced in the myometrium. We have shown previously that activation of protein kinase C in human myometrial cultured cells leads to an up-regulation of cx43 transcription through an activating protein-1 element in the(More)
The role of chromosomally derived micF RNA as a repressor of outer membrane protein OmpF of Escherichia coli was examined for various growth conditions. Levels of micF RNA as determined by Northern analyses are found to increase in response to cell growth at high temperature, in high osmolarity or in the presence of ethanol. After a switch to higher growth(More)
We have characterized the distribution, expression, and hormonal regulation of gap junctions in primary cultures of rat osteoblast-like cells (ROBs), and three osteosarcoma cell lines, ROS 17/2.8, UMR-106, and SAOS-2, and a continuous osteoblastic cell line, MC3T3-E1. All cell lines we examined were functionally coupled. ROS 17/2.8 were the more strongly(More)
Cross-presentation of IgG-containing immune complexes (ICs) is an important means by which dendritic cells (DCs) activate CD8(+) T cells, yet it proceeds by an incompletely understood mechanism. We show that monocyte-derived CD8(-)CD11b(+) DCs require the neonatal Fc receptor for IgG (FcRn) to conduct cross-presentation of IgG ICs. Consequently, in the(More)
Myometrial connexin-43 gap junctions are scarce throughout gestation but appear in large numbers at term to facilitate contractions during labor. The mechanisms that regulate this process are incompletely characterized. This report investigates the effects of protein kinase C activation on the regulation of connexin-43 gene transcription in human uterine(More)
The assembly of the major small nuclear ribonucleoprotein (snRNP) particles begins in the cytoplasm where large pools of common core proteins are preassembled in several RNA-free intermediate particles. Newly synthesized snRNAs transiently enter the cytoplasm and complex with core particles to form pre-snRNP particles. Subsequently, the cap structure at the(More)
micF RNA regulates the levels of outer membrane protein F (OmpF) in Escherichia coli in response to temperature increase and other stress conditions by decreasing the levels of ompF mRNA (Andersen et al., 1989). A 93-nucleotide micF RNA was synthesized in vitro directly from polymerase chain reaction generated DNA which was designed to contain a functional(More)
OBJECTIVE We tested the hypothesis that uterine leiomyomas are hypersensitive to estrogen as compared with autologous human myometrium. METHODS The estrogen-induced transcriptional responses of uterine leiomyoma and myometrial primary cultures were determined by transient expression assays. The relative levels of estrogen receptor (ER) in myometrial and(More)
Complex spatiotemporal changes in intracellular Ca2+ were monitored in an immortalized human myometrial cell line (PHM1-41) and first-passage human myometrial cells after oxytocin stimulation (1. 0-1000 nM). Laser cytometry revealed intracellular Ca2+ oscillations in both culture systems starting at 1.0 nM, which were followed by repetitive Ca2+ transients(More)