Jacques Paoletti

Learn More
Telomeres can fold into t-loops that may result from the invasion of the 3' overhang into duplex DNA. Their formation is facilitated in vitro by the telomeric protein TRF2, but very little is known regarding the mechanisms involved. Here we reveal that TRF2 generates positive supercoiling and condenses DNA. Using a variety of TRF2 mutants, we demonstrate a(More)
Retroviruses contain a dimeric RNA consisting of two identical molecules of genomic RNA. The interaction between the two monomers is thought to occur near their 5'ends. We previously identified a region upstream from the splice donor site, comprising an autocomplementary sequence, responsible for the formation of dimeric HIV-1Lai RNA [Muriaux, D., Girard,(More)
Retroviral genomes consist of two identical RNA molecules joined non-covalently near their 5'-ends. Recently, we showed that an imperfect autocomplementary sequence, located in the L3 domain, plays an essential role in avian sarcoma-leukosis virus (ASLV) RNA dimerization in vitro. This sequence can adopt a stem-loop structure and is involved in ASLV(More)
Nucleocapsid protein 7 (NCp7), the human immunodeficiency virus type 1 (HIV-1) nucleocapsid protein, was shown to strongly potentiate the dimerization of the retroviral genomic RNA. This process involves the interaction of two retroviral RNA monomer subunits near their 5'-ends. A region located upstream from the splice donor site was recently identified as(More)
Retroviruses contain dimeric RNA consisting of two identical copies of the genomic RNA. The interaction between these two RNA molecules occurs near their 5' ends. A region upstream from the splice donor comprising an auto-complementary sequence has been identified as being responsible for the initiation of the formation of dimeric HIV-1(Lai) RNA. This(More)
Dimerization of genomic RNA is directly related with the event of encapsidation and maturation of the virion. The initiating sequence of the dimerization is a short autocomplementary region in the hairpin loop SL1. We describe here a new solution structure of the RNA dimerization initiation site (DIS) of HIV-1(Lai). NMR pulsed field-gradient spin-echo(More)
The nucleocapsid protein NCp7 of the human immunodeficiency virus type 1 contains two zinc fingers of the CX2CX4HX4C type, flanked by several basic residues, and plays a major role in viral infectivity. Thus, NCp7 was shown to promote annealing of the tRNA3Lys to the primer binding site, a key step in reverse transcription. However, previous in vitro(More)
Dimerization of genomic RNA is a key step in the retroviral life cycle and has been postulated to be involved in the regulation of translation, encapsidation and reverse transcription. Here, we have derived a secondary structure model of nucleotides upstream from psi and of the gag initiation region of Mo-MuLV RNA in monomeric and dimeric forms, using(More)
The deoxyoligoribonucleotide d(CTTGCTGAAGCGCGCACGGCAAG) (dSL1) corresponding to the reverse transcripted sequence of the dimerization initiation site SL1 of HIV- 1(Lai) RNA was synthesized using phosphoramidite chemistry. Like its oligoribonucleotide counterpart, dSL1 dimerized spontaneously in solution. Here we report the first NMR solution structure of a(More)
Classical models for DNA triple helix formation assume the stabilization of these structures through the formation of Hoogsteen hydrogen bonds. This assumes that G-rich duplex DNA is more stable than triplex DNA. We report the results of co-migration assay, dimethyl sulfate footprint, and UV spectroscopic melting studies that reveal that at least in some(More)