Learn More
1. Pilocarpine, a muscarinic acetylcholine receptor (mAChR) agonist, is widely used for treatment of xerostomia and glaucoma. It can also cause many other cellular responses by activating different subtypes of mAChRs in different tissues. However, the potential role of pilocarpine in modulating cardiac function remained unstudied. 2. We found that(More)
We have shown previously that estrogen-stimulated transcription from the human lactoferrin gene in RL95-2 endometrium carcinoma cells is mediated through an imperfect estrogen response element (ERE) at the 5 -flanking region of the gene. Upstream from the ERE, a DNA sequence (-418 to -378, FP1) was selectively protected from DNase I digestion by nuclear(More)
In animals and protozoa, gene-specific double-stranded RNA (dsRNA) triggers degradation of homologous cellular RNAs, a phenomenon known as RNA interference (RNAi). In vitro and in vivo dsRNA is processed by a nuclease to produce 21-25-nt small interfering RNAs (siRNAs) that guide target RNA degradation. Here we show that activation of RNAi in Trypanosoma(More)
M2 receptors have long been believed to be the only functional subtype of muscarinic acetylcholine receptor (mAChR) in the heart, although recent studies have provided evidence for the presence of other subtypes. We performed a detailed study to clarify this issue. In the presence of tetramethylammonium (1 microM to 10 mM), a novel K+ current with both(More)
It is now clear that aberrant DNA methylation observed in cancer cells is not restricted to a few CpG islands, but affects multiple loci. When this epigenetic event occurs at the 5'-end of the regulatory region of genes, it is frequently associated with transcriptional silencing. To investigate further this widespread event in the tumor genome, we developed(More)
The properties of the transient outward current (Ito) differ between rabbit and human atrial myocytes. In particular, rabbit Ito is known to recover more slowly than its human counterpart and to show much more frequency dependence. To assess the possibility that these physiological differences may reflect differing expression of K+ channel subunit gene(More)
Cytochrome P4502E1 (CYP2E1) is involved in the metabolic activation of carcinogenic N-nitrosoamines. We therefore assessed the genotype frequencies of PstI or RsaI CYP2E1 restriction fragment length polymorphisms and another susceptibility marker, mutagen sensitivity, in 137 lung cancer cases (92 African American and 45 Mexican American) and 206 controls(More)
BACKGROUND Regeneration of the myocardium and improved ventricular function have been demonstrated in patients with acute myocardial infarction (MI) treated by intracoronary delivery of autologous bone marrow mononuclear cells (BMC) a few days after successful myocardial reperfusion by percutaneous coronary intervention (PCI); however, the effects of(More)
The mouse lactoferrin gene promoter includes a CAAT/GT box, GGGCAATAGGGTGGGGCCAGCCC, which functions as the epidermal growth factor response element (EGFRE) in human endometrial carcinoma RL95-2 cells (RL95). A positive clone, EGFREB, of 2575 bp length, was isolated from an expression library of RL95 cells with a multimer of the EGFRE sequence. In this(More)
rs12979860 in interleukin 28B (IL28B) gene is associated with response to interferon-α therapy and natural viral clearance in hepatitis C. The role of this polymorphism is less known in hepatitis B virus (HBV) infection. We evaluated whether rs12979860 was associated with outcomes of HBV infection. There were 651 individuals with persistent infection (387(More)