Hongjun Zou

  • Citations Per Year
Learn More
Growing evidence indicates that microRNAs (miRNAs) are important mediators of brain development and neurite growth. However, the affected signaling mechanisms are not clearly clarified. In the present study, we confirm that miR-29c is expressed during mice brain development and increases neurite outgrowth via decreasing PTEN expression. We first screen the(More)
Schwann cell (SC) transplantation as a cell-based therapy can enhance peripheral and central nerve repair experimentally, but it is limited by the donor site morbidity for clinical application. We investigated weather respiratory mucosa stem cells (REMSCs), a kind of ectomesenchymal stem cells (EMSCs), isolated from rat nasal septum can differentiate into(More)
The aim of this study is to identify rat nasal septum respiratory mucosa-derived mesenchyme stem cells (RM-MSCs) and to compare its neural lineage differentiation capacity with bone marrow-derived mesenchyme stem cells (BM-MSCs) after a short period of neural induction culture in vitro. The cell morphology was observed with light microscopy; cell(More)
In the original publication of the article, there were errors in primer sequences under the section ‘‘Expression Plasmids’’ and in Table 1. The corrected text and the table have been presented with this erratum. In the section titled, ‘‘Expression Plasmids’’ the primer sequence ‘‘Forward: ccggtgaccgatttctcctggtgttcctcgaggaa caccaggagaaatcggtcatttttg;(More)
BACKGROUND Recently, nomograms have been used as models for risk prediction in malignant tumor because they can predict the outcome of interest for a certain individual based on many variables. This study aimed to establish an effective prognostic nomogram for osteosarcoma based on the clinicopathological factors and microRNA-203. RESULTS The results(More)
INTRODUCTION This study aimed to elucidate the prognostic value of microRNAs (miRNAs) in patients with osteosarcoma. MATERIALS AND METHODS Studies were recruited by searching PubMed, Embase, the Cochrane Library, China National Knowledge Infrastructure, and Wanfang data-bases (final search update conducted January 2017). Eligible studies were identified(More)
  • 1