Learn More
Hematopoietic stem progenitor cells (HSPCs) respond robustly to α-chemokine stromal-derived factor-1 (SDF-1) gradients, and blockage of CXCR4, a seven-transmembrane-spanning GαI-protein-coupled SDF-1 receptor, mobilizes HSPCs into peripheral blood. Although the SDF-1–CXCR4 axis has an unquestionably important role in the retention of HSPCs in bone marrow(More)
We report that the bone marrow (BM) stroma-released LL-37, a member of the cathelicidin family of antimicrobial peptides, primes/increases the responsiveness of murine and human hematopoietic stem/progenitor cells (HSPCs) to an α-chemokine stromal-derived factor-1 (SDF-1) gradient. Accordingly, LL-37 is upregulated in irradiated BM cells and enhances the(More)
Hematopoietic stem and progenitor cells (HSPCs), as well as other types of stem cells, circulate under steady-state conditions at detectable levels in peripheral blood (PB), with their numbers increasing in response to stress, inflammation and tissue/organ injury. This mobilization process may be envisioned as a danger-sensing response mechanism triggered(More)
We have observed that conditioning for hematopoietic transplantation by lethal irradiation induces a proteolytic microenvironment in the bone marrow (BM) that activates the complement cascade (CC). As a result, BM is enriched for proteolytic enzymes and the soluble form of the terminal product of CC activation, the membrane attack complex C5b-C9 (MAC). At(More)
SR designed and performed experiments, wrote the first draft of the manuscript, contributed to revisions of the paper, and approved the final submitted version. CC provided input into experimental design, performed experiments, and reviewed and approved the final version of the manuscript. DJ and XM assisted in design of experiments, performed the(More)
Hunter syndrome (Mucopolysaccharidosis type II, MPS2) is an X-linked recessively inherited disease caused by a deficiency of iduronate 2 sulfatase (IDS). In this study, we investigated mutations of the IDS gene in 25 Korean Hunter syndrome patients. We identified 20 mutations, of which 13 mutations are novel; 6 small deletions (69_88delCCTCGGATCCGAAACGCAGG,(More)
Mucopolysaccharidosis II (MPS II, Hunter syndrome; OMIM 309900) is an X-linked lysosomal storage disease caused by a deficiency in the enzyme iduronate-2-sulfatase (IDS), leading to accumulation of glycosaminoglycans (GAGs). For enzyme replacement therapy (ERT) of Hunter syndrome, two recombinant enzymes, idursulfase (Elaprase®, Shire Human Genetic(More)
Short-chain acyl-coenzyme A dehydrogenase deficiency (SCADD) is an autosomal recessive disorder of mitochondrial fatty acid oxidation associated with mutations in the ACADS gene (Acyl-CoA Dehydrogenase, Short-chain, OMIM #606885). SCADD is a heterogeneous condition that has been associated with various clinical phenotypes ranging from fetal metabolic(More)
The natural progression of the severe form of mucopolysaccharidosis II in children is a rapid decline of neurodevelopmental function with hydrocephalus. Recombinant human iduronate-2-sulfatase enzyme replacement therapy (ERT) under a standard regimen seems to have limited effect. Therefore, we determined whether early, high-dose ERT attenuated(More)
CONTEXT Prader-Willi syndrome (PWS), a genetic disorder characterized by obesity in early childhood, is reported to have elevated levels of adiponectin. The effects of adiponectin are mediated by adiponectin receptors (ADIPORs) that include ADIPOR1 and ADIPOR2. There is evidence that several cytokines, including adiponectin, TNF-alpha, and IL-6, are(More)