Chantal B.E.M. Reusken

Learn More
We found serologic evidence for the circulation of Middle East respiratory syndrome coronavirus among dromedary camels in Nigeria, Tunisia, and Ethiopia. Circulation of the virus among dromedaries across broad areas of Africa may indicate that this disease is currently underdiagnosed in humans outside the Arabian Peninsula.
We determined the presence of neutralizing antibodies to Middle East respiratory syndrome coronavirus in persons in Qatar with and without dromedary contact. Antibodies were only detected in those with contact, suggesting dromedary exposure as a risk factor for infection. Findings also showed evidence for substantial underestimation of the infection in(More)
We obtained the full genome of Middle East respiratory syndrome coronavirus (MERS-CoV) from a camel in Qatar. This virus is highly similar to the human England/Qatar 1 virus isolated in 2012. The MERS-CoV from the camel efficiently replicated in human cells, providing further evidence for the zoonotic potential of MERS-CoV from camels.
Technical Appendix Table 1. Primers for amplification and sequencing of the plasminogen activator gene* Forward primer Sequence (5 →3 ) Reverse primer Sequence (5 →3 ) Position† plasq-f ATGAAAATCAATCTGAGTGGACAGATCAC plasq-r CAGAAGCGATATTGCAGAC 6990–7602 plasq2-f TAACTATTCTGTCCGGGAGT plasq2-r ATTATCATGTGCCCGAAC 6696–7339 *pla, plasminogen(More)
We screened squirrels in Germany and the Netherlands for the novel zoonotic variegated squirrel bornavirus 1 (VSBV-1). The detection of VSBV-1 in 11 squirrels indicates a considerable risk for transmission to humans handling those animals. Therefore, squirrels in contact with humans should routinely be tested for VSBV-1.
Middle East respiratory syndrome coronavirus (MERS-CoV) has caused an ongoing outbreak of severe acute respiratory tract infection in humans in the Arabian Peninsula since 2012. Dromedary camels have been implicated as possible viral reservoirs. We used serologic assays to analyze 651 dromedary camel serum samples from the United Arab Emirates; 151 of 651(More)
  • 1