• Publications
  • Influence
DNA methylation of the human oxytocin receptor gene promoter regulates tissue-specific gene suppression.
In the human oxytocin receptor (OTR) gene, there is a CpG island from 140 bp upstream to 2338 bp downstream of the transcription start site (TSS). We investigated whether the methylation state ofExpand
  • 116
  • 13
Molecular cloning of a human MafF homologue, which specifically binds to the oxytocin receptor gene in term myometrium.
The US-2 DNA-binding element (ggaatgattactcagctaga) in the promoter of the human oxytocin receptor (OTR) gene has been shown to bind specifically nuclear proteins from human myometrium atExpand
  • 29
  • 2
What knockout mice can tell us about parturition.
Many molecules, including steroid and peptide hormones, prostaglandins and cytokines, regulate the preparation, initiation and progression of parturition in mammals. Gene targeting studies show that,Expand
  • 43
  • 1
Effectiveness of Hormonal Tourniquet by Vasopressin during Myomectomy through Vasopressin V1a Receptor Ubiquitously Expressed in Myometrium
To elucidate the mechanism by which myometrial vasopressin injection promotes hemostasis during myomectomy, we examined the expression of vasopressin V1a receptor transcripts in the myometrium.Expand
  • 14
Cloning, expression and gene regulation of a human oxytocin receptor in pregnant uterus
Objectives: The aim of the study was to investigate the Bcl-2 and Bax expression in endometriotic and adenomyotic tissues. Study Methods: 56 tissue samples were collected during gynecological surgeryExpand