Learn More
The DNA oligomer 5'-d(TGCGGCCTCTCAGTCCCGCACTTTCATCTTCC)-3' specifically recognizes Haemophilus influenzae 16S rRNA. We report here the use of this oligonucleotide, with a fluorescein label tagged on(More)
Two Salmonella typhi mutants, 541Ty (Vi+) and 543Ty (Vi-), auxotrophic for p-aminobenzoate and adenine, were evaluated as live oral vaccines. 33 volunteers ingested single doses of 10(8), 10(9), or(More)