Alan K. Todd

Learn More
G-quadruplexes are higher-order DNA and RNA structures formed from G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential quadruplex sequences have been identified in G-rich eukaryotic telomeres, and more recently in non-telomeric genomic DNA, e.g. in nuclease-hypersensitive promoter regions. The natural role and(More)
G-quadruplexes are higher-order DNA and RNA structures formed from G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential quadruplex sequences have been identified in G-rich eukaryotic telomeres, and more recently in non-telomeric genomic DNA, e.g. in nuclease-hypersensitive promoter regions. The natural role and(More)
The 22-nt c-kit87 promoter sequence is unique within the human genome. Its fold and tertiary structure have recently been determined by NMR methods [Phan,A.T., Kuryavyi,V., Burge,S., Neidle,S. and Patel,D.J. (2007) Structure of an unprecedented G-quadruplex scaffold in the c-kit promoter. J. Am. Chem. Soc., 129, 4386-4392], and does not have precedent among(More)
The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence forms a four-stranded quadruplex structure under physiological conditions. Variations in the sequences that intervene between the guanine(More)
We have carried out a survey of potential quadruplex structure sequences (PQSS), which occur in the immediate upstream region (500 bp) of human genes. By examining the number and distribution of these we have established that there is a clear link between them and the occurrence of the SP1-binding element 'GGGCGG', such that a large number of upstream PQSS(More)
The integrity of telomeres in most cancer cells is maintained by the action of the telomerase enzyme complex, which catalyzes the synthesis of telomeric DNA repeats in order to replace those lost during replication. Telomerase is especially up-regulated in metastatic cancer and is thus emerging as a major therapeutic target. One approach to telomerase(More)
We report here the results of a systematic search for the existence and prevalence of potential intramolecular G-quadruplex forming sequences in the human genome. We have also examined the tendency for particular sequences of 'loop' regions to occur in particular positions with respect to the G-tracts in a quadruplex. Using arithmetic ratio and probability(More)
The sequence d(GGGCGGGGAGGGGGAAGGGA) occurs in the promoter region of the B-raf gene. An X-ray crystallographic study has found that this forms an unprecedented dimeric quadruplex arrangement, with a core of seven consecutive G-quartets and an uninterrupted run of six potassium ions in the central channel of the quadruplex. Analogy with previously reported(More)
Signal Transducers and Activators of Transcription (STAT) proteins are a group of latent cytoplasmic transcription factors involved in cytokine signaling. STAT3 is a member of the STAT family and is expressed at elevated levels in a large number of diverse human cancers and is now a validated target for anticancer drug discovery.. Understanding the dynamics(More)