Learn More
G-quadruplexes are higher-order DNA and RNA structures formed from G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential quadruplex sequences have been identified in G-rich eukaryotic telomeres, and more recently in non-telomeric genomic DNA, e.g. in nuclease-hypersensitive promoter regions. The natural role and(More)
We report here the results of a systematic search for the existence and prevalence of potential intramolecular G-quadruplex forming sequences in the human genome. We have also examined the tendency for particular sequences of 'loop' regions to occur in particular positions with respect to the G-tracts in a quadruplex. Using arithmetic ratio and probability(More)
The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence forms a four-stranded quadruplex structure under physiological conditions. Variations in the sequences that intervene between the guanine(More)
We have carried out a survey of potential quadruplex structure sequences (PQSS), which occur in the immediate upstream region (500 bp) of human genes. By examining the number and distribution of these we have established that there is a clear link between them and the occurrence of the SP1-binding element 'GGGCGG', such that a large number of upstream PQSS(More)
The 22-nt c-kit87 promoter sequence is unique within the human genome. Its fold and tertiary structure have recently been determined by NMR methods [Phan,A.T., Kuryavyi,V., Burge,S., Neidle,S. and Patel,D.J. (2007) Structure of an unprecedented G-quadruplex scaffold in the c-kit promoter. J. Am. Chem. Soc., 129, 4386-4392], and does not have precedent among(More)
The knowledge that potential guanine quadruplex sequences (PQs) are non-randomly distributed in relation to genomic features is now well established. However, this is for a general potential quadruplex motif which is characterized by short runs of guanine separated by loop regions, regardless of the nature of the loop sequence. There have been no studies to(More)
The first X-ray crystal structures of nickel(II) and copper(II) salphen metal complexes bound to a quadruplex DNA are presented. Two structures have been determined and show that these salphen-metal complexes bind to human telomeric quadruplexes by end-stacking, with the metal in each case almost in line with the potassium ion channel. Quadruplex and duplex(More)
The integrity of telomeres in most cancer cells is maintained by the action of the telomerase enzyme complex, which catalyzes the synthesis of telomeric DNA repeats in order to replace those lost during replication. Telomerase is especially up-regulated in metastatic cancer and is thus emerging as a major therapeutic target. One approach to telomerase(More)
The structure of the duplex d[CG(5-BrU)ACG](2) bound to 9-bromophenazine-4-carboxamide has been solved through MAD phasing at 2.0 A resolution. It shows an unexpected and previously unreported intercalation cavity stabilized by the drug and novel binding modes of Co(2+) ions at certain guanine N7 sites. For the intercalation cavity the terminal cytosine is(More)