Learn More
Centromere protein A (Cenpa for mouse, CENP-A for other species) is a histone H3-like protein that is thought to be involved in the nucleosomal packaging of centromeric DNA. Using gene targeting, we have disrupted the mouse Cenpa gene and demonstrated that the gene is essential. Heterozygous mice are healthy and fertile whereas null mutants fail to survive(More)
A double-blind, pair-matched 12-mo study examined the effects of a zinc supplement (10 mg Zn/d as ZnSO4) on linear growth, taste acuity, attention span, biochemical indices, and energy intakes of 60 boys (aged 5-7 y) with height less than or equal to 15th and midparent height greater than 25th percentiles. Boys with initial hair Zn less than 1.68 mumol/g (n(More)
Thirty-three cases (24 definite, nine probable) of Q fever were diagnosed in Victoria County, Cape Breton, Nova Scotia from May to August, 1985. Twenty-six of the cases occurred in residents of Baddeck (population 900, attack rate 2.8 percent), and 21 of the cases occurred during the month of June. There was geographic clustering of the cases: 14 of the 33(More)
A double-stranded 9 bp GTGAAAAAG pJ alpha sequence found in human centromeric alpha-satellite DNA and a 28 bp ATGTATATATGTGTATATAGACATAAAT tandemly repeated AT28 sequence found within a cloned neo- centromere DNA have each allowed the affinity purification of a nuclear protein that we have identified as poly(ADP-ribose) polymerase (PARP). Use of other(More)
The zinc, copper, and selenium status of 90 noninstitutionalized Canadian elderly women (M age = 70.3 years) in a university community and consuming self-selected diets was assessed using hair and serum trace element levels and dietary trace element intakes. Mean (+/- SD) serum zinc and copper levels (analyzed via atomic absorption spectrophotometry, AA)(More)
Two hundred nine hypertensive patients with high stimulated plasma renin levels were screened for renovascular hypertension using Tc-99m DTPA renal scintigraphy. Differential glomerular filtration rate (Diff-GFR) was obtained by integrating the area under the background-subtracted renogram of each kidney between 1 and 3 minutes. 50 patients who also had(More)
ECG-gated thallium-201 perfusion images (GT) may provide information concerning left ventricular contraction. To assess the objectivity of this information, qualitative and quantitative evaluations of left anterior oblique GT images were performed in 600 patients and compared with contrast ventriculography (n = 180) and gated blood pool scintigraphy (n =(More)
Left ventricular function and volume changes during supine isotonic exercise were assessed in 32 patients with coronary artery disease (CAD) and 12 normal subjects by electrocardiographically gated blood pool cardiac scintigraphy. Ejection fraction (EF) in normal subjects was 49 +/- 10% at rest, 54 +/- 10% during intermediate exercise (P less than 0.05 vs.(More)
Proximal occipital scalp hair samples were collected during three survey periods from 30 omniverous Canadian boys aged 75.6 +/- 10.4 months (mean +/- SD) and 66 rural Malawian children (37 M; 29 F) aged 62 +/- 10 months (mean +/- SD) consuming predominantly plant-based diets. Hair samples were washed and then analyzed for zinc and copper using instrumental(More)
A pilot study of telemedicine consultations of 51 dermatology patients showed that the technology worked well, with the diagnosis being able to be made in most patients and over half of the patients being able to be dealt with through this medium only. It could therefore have a valuable screening role. However, many of the patients, in spite of the obvious(More)