A L Kaiushin

  • Citations Per Year
Learn More
New allele-specific primers were developed which enable the facile and effective identification of the Leiden mutation in the human genome using PCR. One of the primers (allele-nonspecific), which is complementary to the nucleotide sequence of the intron 10 sense strand, [(5')TCTCTTGAAGGAAATGCCCCATTA], was described by B. Dahlback in 1994. Two other primers(More)
Potential sites of the complementary interaction of the translation initiation region (TIR) with 16S rRNA are revealed, and the role of these sites in the gene expression level is studied. The high expression level of a gene depends not only on the complementary interaction of TIR with 16S rRNA in sites proximal to the start codon [anti-Shine-Dalgarno (ASD)(More)
The expression levels of genes that are transcribed to give mRNAs with identical leader sequences and even with identical extended coding regions may differ considerably. In order to determine the mechanism of this phenomenon, secondary structures of some mRNAs synthesized from a series of expression plasmids were studied. It was shown that the effect of(More)
Artificial genes for chains A and B of ectatomin, an Ectatomma tuberculatum ant toxin, were obtained by chemical and enzymic synthesis and cloned into new plasmid vectors. Expression plasmids with the genes of hybrid proteins were constructed containing human interleukin-3 or its terminal 63-mer fragment as well as chains A and B of ectatomin, which are(More)
To evaluate the effect on translation of distal regions of the encoding mRNA part capable of the complementary binding to the ribosome binding site (RBS), a series of plasmids were constructed containing fragments inserted into the il3 gene and determining secondary interactions in mRNA. A comparison of the levels of the in vivo gene expression showed that(More)
A straightforward and effective PCR-based assay system is devised that allows one to reveal and identify homozygous and heterozygous point mutations. The system uses two sets of allele-specific primers. In one set, the 3'-nucleotide matches the allele under study so that the primer functions effectively only if the DNA contains the corresponding allele. To(More)
MALDI mass spectrometry (MS) of 14- to 42-mer homogeneous oligonucleotides and their mixtures was carried out using a Vision 2000 instrument (Thermo BioAnalysis, Finnigan, United States). Conditions for the determination of oligonucleotide molecular masses were optimized by applying various matrices and operation modes. The most reproducible results with(More)
A full-length cDNA of the rpb8+ gene encoding a common subunit Rpb8 of nuclear RNA polymerases I-III only specific for Eucarya was isolated from an expression library of the fission yeast Schizosaccharomyces pombe. The primary structure of the corresponding fragment of the Sz. pombe genome was also established. The rpb8+ gene contains two short introns, 59(More)